diff --git a/.gitattributes b/.gitattributes
index 2635f9cbbd98377405c62ee003f1d6b4b772e7b2..92ea1bdb2c9ec8a64a67de6786593585a870927f 100644
--- a/.gitattributes
+++ b/.gitattributes
@@ -1 +1,8 @@
 **/dataset/** filter=lfs diff=lfs merge=lfs -text
+_publication/41598_2024_63226_MOESM5_ESM.pdf filter=lfs diff=lfs merge=lfs -text
+_publication/41598_2024_63226_MOESM8_ESM.zip filter=lfs diff=lfs merge=lfs -text
+_publication/s41598-024-63226-1.pdf filter=lfs diff=lfs merge=lfs -text
+_publication/41598_2024_63226_MOESM4_ESM.mp4 filter=lfs diff=lfs merge=lfs -text
+studies/RoPodChamberPrinting/resources/41598_2024_63226_MOESM6_ESM.zip filter=lfs diff=lfs merge=lfs -text
+assays/RootLengthMeasurement/dataset/41598_2024_63226_MOESM1_ESM.mp4 filter=lfs diff=lfs merge=lfs -text
+assays/AutophagicActivityAssay/dataset/41598_2024_63226_MOESM3_ESM.mp4 filter=lfs diff=lfs merge=lfs -text
diff --git a/LICENSE b/LICENSE
new file mode 100644
index 0000000000000000000000000000000000000000..72a6ea045890537da6f7211866151189f452557c
--- /dev/null
+++ b/LICENSE
@@ -0,0 +1,395 @@
+Attribution 4.0 International
+
+=======================================================================
+
+Creative Commons Corporation ("Creative Commons") is not a law firm and
+does not provide legal services or legal advice. Distribution of
+Creative Commons public licenses does not create a lawyer-client or
+other relationship. Creative Commons makes its licenses and related
+information available on an "as-is" basis. Creative Commons gives no
+warranties regarding its licenses, any material licensed under their
+terms and conditions, or any related information. Creative Commons
+disclaims all liability for damages resulting from their use to the
+fullest extent possible.
+
+Using Creative Commons Public Licenses
+
+Creative Commons public licenses provide a standard set of terms and
+conditions that creators and other rights holders may use to share
+original works of authorship and other material subject to copyright
+and certain other rights specified in the public license below. The
+following considerations are for informational purposes only, are not
+exhaustive, and do not form part of our licenses.
+
+     Considerations for licensors: Our public licenses are
+     intended for use by those authorized to give the public
+     permission to use material in ways otherwise restricted by
+     copyright and certain other rights. Our licenses are
+     irrevocable. Licensors should read and understand the terms
+     and conditions of the license they choose before applying it.
+     Licensors should also secure all rights necessary before
+     applying our licenses so that the public can reuse the
+     material as expected. Licensors should clearly mark any
+     material not subject to the license. This includes other CC-
+     licensed material, or material used under an exception or
+     limitation to copyright. More considerations for licensors:
+    wiki.creativecommons.org/Considerations_for_licensors
+
+     Considerations for the public: By using one of our public
+     licenses, a licensor grants the public permission to use the
+     licensed material under specified terms and conditions. If
+     the licensor's permission is not necessary for any reason--for
+     example, because of any applicable exception or limitation to
+     copyright--then that use is not regulated by the license. Our
+     licenses grant only permissions under copyright and certain
+     other rights that a licensor has authority to grant. Use of
+     the licensed material may still be restricted for other
+     reasons, including because others have copyright or other
+     rights in the material. A licensor may make special requests,
+     such as asking that all changes be marked or described.
+     Although not required by our licenses, you are encouraged to
+     respect those requests where reasonable. More considerations
+     for the public:
+    wiki.creativecommons.org/Considerations_for_licensees
+
+=======================================================================
+
+Creative Commons Attribution 4.0 International Public License
+
+By exercising the Licensed Rights (defined below), You accept and agree
+to be bound by the terms and conditions of this Creative Commons
+Attribution 4.0 International Public License ("Public License"). To the
+extent this Public License may be interpreted as a contract, You are
+granted the Licensed Rights in consideration of Your acceptance of
+these terms and conditions, and the Licensor grants You such rights in
+consideration of benefits the Licensor receives from making the
+Licensed Material available under these terms and conditions.
+
+
+Section 1 -- Definitions.
+
+  a. Adapted Material means material subject to Copyright and Similar
+     Rights that is derived from or based upon the Licensed Material
+     and in which the Licensed Material is translated, altered,
+     arranged, transformed, or otherwise modified in a manner requiring
+     permission under the Copyright and Similar Rights held by the
+     Licensor. For purposes of this Public License, where the Licensed
+     Material is a musical work, performance, or sound recording,
+     Adapted Material is always produced where the Licensed Material is
+     synched in timed relation with a moving image.
+
+  b. Adapter's License means the license You apply to Your Copyright
+     and Similar Rights in Your contributions to Adapted Material in
+     accordance with the terms and conditions of this Public License.
+
+  c. Copyright and Similar Rights means copyright and/or similar rights
+     closely related to copyright including, without limitation,
+     performance, broadcast, sound recording, and Sui Generis Database
+     Rights, without regard to how the rights are labeled or
+     categorized. For purposes of this Public License, the rights
+     specified in Section 2(b)(1)-(2) are not Copyright and Similar
+     Rights.
+
+  d. Effective Technological Measures means those measures that, in the
+     absence of proper authority, may not be circumvented under laws
+     fulfilling obligations under Article 11 of the WIPO Copyright
+     Treaty adopted on December 20, 1996, and/or similar international
+     agreements.
+
+  e. Exceptions and Limitations means fair use, fair dealing, and/or
+     any other exception or limitation to Copyright and Similar Rights
+     that applies to Your use of the Licensed Material.
+
+  f. Licensed Material means the artistic or literary work, database,
+     or other material to which the Licensor applied this Public
+     License.
+
+  g. Licensed Rights means the rights granted to You subject to the
+     terms and conditions of this Public License, which are limited to
+     all Copyright and Similar Rights that apply to Your use of the
+     Licensed Material and that the Licensor has authority to license.
+
+  h. Licensor means the individual(s) or entity(ies) granting rights
+     under this Public License.
+
+  i. Share means to provide material to the public by any means or
+     process that requires permission under the Licensed Rights, such
+     as reproduction, public display, public performance, distribution,
+     dissemination, communication, or importation, and to make material
+     available to the public including in ways that members of the
+     public may access the material from a place and at a time
+     individually chosen by them.
+
+  j. Sui Generis Database Rights means rights other than copyright
+     resulting from Directive 96/9/EC of the European Parliament and of
+     the Council of 11 March 1996 on the legal protection of databases,
+     as amended and/or succeeded, as well as other essentially
+     equivalent rights anywhere in the world.
+
+  k. You means the individual or entity exercising the Licensed Rights
+     under this Public License. Your has a corresponding meaning.
+
+
+Section 2 -- Scope.
+
+  a. License grant.
+
+       1. Subject to the terms and conditions of this Public License,
+          the Licensor hereby grants You a worldwide, royalty-free,
+          non-sublicensable, non-exclusive, irrevocable license to
+          exercise the Licensed Rights in the Licensed Material to:
+
+            a. reproduce and Share the Licensed Material, in whole or
+               in part; and
+
+            b. produce, reproduce, and Share Adapted Material.
+
+       2. Exceptions and Limitations. For the avoidance of doubt, where
+          Exceptions and Limitations apply to Your use, this Public
+          License does not apply, and You do not need to comply with
+          its terms and conditions.
+
+       3. Term. The term of this Public License is specified in Section
+          6(a).
+
+       4. Media and formats; technical modifications allowed. The
+          Licensor authorizes You to exercise the Licensed Rights in
+          all media and formats whether now known or hereafter created,
+          and to make technical modifications necessary to do so. The
+          Licensor waives and/or agrees not to assert any right or
+          authority to forbid You from making technical modifications
+          necessary to exercise the Licensed Rights, including
+          technical modifications necessary to circumvent Effective
+          Technological Measures. For purposes of this Public License,
+          simply making modifications authorized by this Section 2(a)
+          (4) never produces Adapted Material.
+
+       5. Downstream recipients.
+
+            a. Offer from the Licensor -- Licensed Material. Every
+               recipient of the Licensed Material automatically
+               receives an offer from the Licensor to exercise the
+               Licensed Rights under the terms and conditions of this
+               Public License.
+
+            b. No downstream restrictions. You may not offer or impose
+               any additional or different terms or conditions on, or
+               apply any Effective Technological Measures to, the
+               Licensed Material if doing so restricts exercise of the
+               Licensed Rights by any recipient of the Licensed
+               Material.
+
+       6. No endorsement. Nothing in this Public License constitutes or
+          may be construed as permission to assert or imply that You
+          are, or that Your use of the Licensed Material is, connected
+          with, or sponsored, endorsed, or granted official status by,
+          the Licensor or others designated to receive attribution as
+          provided in Section 3(a)(1)(A)(i).
+
+  b. Other rights.
+
+       1. Moral rights, such as the right of integrity, are not
+          licensed under this Public License, nor are publicity,
+          privacy, and/or other similar personality rights; however, to
+          the extent possible, the Licensor waives and/or agrees not to
+          assert any such rights held by the Licensor to the limited
+          extent necessary to allow You to exercise the Licensed
+          Rights, but not otherwise.
+
+       2. Patent and trademark rights are not licensed under this
+          Public License.
+
+       3. To the extent possible, the Licensor waives any right to
+          collect royalties from You for the exercise of the Licensed
+          Rights, whether directly or through a collecting society
+          under any voluntary or waivable statutory or compulsory
+          licensing scheme. In all other cases the Licensor expressly
+          reserves any right to collect such royalties.
+
+
+Section 3 -- License Conditions.
+
+Your exercise of the Licensed Rights is expressly made subject to the
+following conditions.
+
+  a. Attribution.
+
+       1. If You Share the Licensed Material (including in modified
+          form), You must:
+
+            a. retain the following if it is supplied by the Licensor
+               with the Licensed Material:
+
+                 i. identification of the creator(s) of the Licensed
+                    Material and any others designated to receive
+                    attribution, in any reasonable manner requested by
+                    the Licensor (including by pseudonym if
+                    designated);
+
+                ii. a copyright notice;
+
+               iii. a notice that refers to this Public License;
+
+                iv. a notice that refers to the disclaimer of
+                    warranties;
+
+                 v. a URI or hyperlink to the Licensed Material to the
+                    extent reasonably practicable;
+
+            b. indicate if You modified the Licensed Material and
+               retain an indication of any previous modifications; and
+
+            c. indicate the Licensed Material is licensed under this
+               Public License, and include the text of, or the URI or
+               hyperlink to, this Public License.
+
+       2. You may satisfy the conditions in Section 3(a)(1) in any
+          reasonable manner based on the medium, means, and context in
+          which You Share the Licensed Material. For example, it may be
+          reasonable to satisfy the conditions by providing a URI or
+          hyperlink to a resource that includes the required
+          information.
+
+       3. If requested by the Licensor, You must remove any of the
+          information required by Section 3(a)(1)(A) to the extent
+          reasonably practicable.
+
+       4. If You Share Adapted Material You produce, the Adapter's
+          License You apply must not prevent recipients of the Adapted
+          Material from complying with this Public License.
+
+
+Section 4 -- Sui Generis Database Rights.
+
+Where the Licensed Rights include Sui Generis Database Rights that
+apply to Your use of the Licensed Material:
+
+  a. for the avoidance of doubt, Section 2(a)(1) grants You the right
+     to extract, reuse, reproduce, and Share all or a substantial
+     portion of the contents of the database;
+
+  b. if You include all or a substantial portion of the database
+     contents in a database in which You have Sui Generis Database
+     Rights, then the database in which You have Sui Generis Database
+     Rights (but not its individual contents) is Adapted Material; and
+
+  c. You must comply with the conditions in Section 3(a) if You Share
+     all or a substantial portion of the contents of the database.
+
+For the avoidance of doubt, this Section 4 supplements and does not
+replace Your obligations under this Public License where the Licensed
+Rights include other Copyright and Similar Rights.
+
+
+Section 5 -- Disclaimer of Warranties and Limitation of Liability.
+
+  a. UNLESS OTHERWISE SEPARATELY UNDERTAKEN BY THE LICENSOR, TO THE
+     EXTENT POSSIBLE, THE LICENSOR OFFERS THE LICENSED MATERIAL AS-IS
+     AND AS-AVAILABLE, AND MAKES NO REPRESENTATIONS OR WARRANTIES OF
+     ANY KIND CONCERNING THE LICENSED MATERIAL, WHETHER EXPRESS,
+     IMPLIED, STATUTORY, OR OTHER. THIS INCLUDES, WITHOUT LIMITATION,
+     WARRANTIES OF TITLE, MERCHANTABILITY, FITNESS FOR A PARTICULAR
+     PURPOSE, NON-INFRINGEMENT, ABSENCE OF LATENT OR OTHER DEFECTS,
+     ACCURACY, OR THE PRESENCE OR ABSENCE OF ERRORS, WHETHER OR NOT
+     KNOWN OR DISCOVERABLE. WHERE DISCLAIMERS OF WARRANTIES ARE NOT
+     ALLOWED IN FULL OR IN PART, THIS DISCLAIMER MAY NOT APPLY TO YOU.
+
+  b. TO THE EXTENT POSSIBLE, IN NO EVENT WILL THE LICENSOR BE LIABLE
+     TO YOU ON ANY LEGAL THEORY (INCLUDING, WITHOUT LIMITATION,
+     NEGLIGENCE) OR OTHERWISE FOR ANY DIRECT, SPECIAL, INDIRECT,
+     INCIDENTAL, CONSEQUENTIAL, PUNITIVE, EXEMPLARY, OR OTHER LOSSES,
+     COSTS, EXPENSES, OR DAMAGES ARISING OUT OF THIS PUBLIC LICENSE OR
+     USE OF THE LICENSED MATERIAL, EVEN IF THE LICENSOR HAS BEEN
+     ADVISED OF THE POSSIBILITY OF SUCH LOSSES, COSTS, EXPENSES, OR
+     DAMAGES. WHERE A LIMITATION OF LIABILITY IS NOT ALLOWED IN FULL OR
+     IN PART, THIS LIMITATION MAY NOT APPLY TO YOU.
+
+  c. The disclaimer of warranties and limitation of liability provided
+     above shall be interpreted in a manner that, to the extent
+     possible, most closely approximates an absolute disclaimer and
+     waiver of all liability.
+
+
+Section 6 -- Term and Termination.
+
+  a. This Public License applies for the term of the Copyright and
+     Similar Rights licensed here. However, if You fail to comply with
+     this Public License, then Your rights under this Public License
+     terminate automatically.
+
+  b. Where Your right to use the Licensed Material has terminated under
+     Section 6(a), it reinstates:
+
+       1. automatically as of the date the violation is cured, provided
+          it is cured within 30 days of Your discovery of the
+          violation; or
+
+       2. upon express reinstatement by the Licensor.
+
+     For the avoidance of doubt, this Section 6(b) does not affect any
+     right the Licensor may have to seek remedies for Your violations
+     of this Public License.
+
+  c. For the avoidance of doubt, the Licensor may also offer the
+     Licensed Material under separate terms or conditions or stop
+     distributing the Licensed Material at any time; however, doing so
+     will not terminate this Public License.
+
+  d. Sections 1, 5, 6, 7, and 8 survive termination of this Public
+     License.
+
+
+Section 7 -- Other Terms and Conditions.
+
+  a. The Licensor shall not be bound by any additional or different
+     terms or conditions communicated by You unless expressly agreed.
+
+  b. Any arrangements, understandings, or agreements regarding the
+     Licensed Material not stated herein are separate from and
+     independent of the terms and conditions of this Public License.
+
+
+Section 8 -- Interpretation.
+
+  a. For the avoidance of doubt, this Public License does not, and
+     shall not be interpreted to, reduce, limit, restrict, or impose
+     conditions on any use of the Licensed Material that could lawfully
+     be made without permission under this Public License.
+
+  b. To the extent possible, if any provision of this Public License is
+     deemed unenforceable, it shall be automatically reformed to the
+     minimum extent necessary to make it enforceable. If the provision
+     cannot be reformed, it shall be severed from this Public License
+     without affecting the enforceability of the remaining terms and
+     conditions.
+
+  c. No term or condition of this Public License will be waived and no
+     failure to comply consented to unless expressly agreed to by the
+     Licensor.
+
+  d. Nothing in this Public License constitutes or may be interpreted
+     as a limitation upon, or waiver of, any privileges and immunities
+     that apply to the Licensor or You, including from the legal
+     processes of any jurisdiction or authority.
+
+
+=======================================================================
+
+Creative Commons is not a party to its public
+licenses. Notwithstanding, Creative Commons may elect to apply one of
+its public licenses to material it publishes and in those instances
+will be considered the “Licensor.” The text of the Creative Commons
+public licenses is dedicated to the public domain under the CC0 Public
+Domain Dedication. Except for the limited purpose of indicating that
+material is shared under a Creative Commons public license or as
+otherwise permitted by the Creative Commons policies published at
+creativecommons.org/policies, Creative Commons does not authorize the
+use of the trademark "Creative Commons" or any other trademark or logo
+of Creative Commons without its prior written consent including,
+without limitation, in connection with any unauthorized modifications
+to any of its public licenses or any other arrangements,
+understandings, or agreements concerning use of licensed material. For
+the avoidance of doubt, this paragraph does not form part of the
+public licenses.
+
+Creative Commons may be contacted at creativecommons.org.
diff --git a/README.md b/README.md
index fc7b7cbf35746226a66f15ee57fa6001bdc6e038..fd6e7f762c259e0afca0d3f410c55efa6a5acf1d 100644
--- a/README.md
+++ b/README.md
@@ -3,6 +3,8 @@
 
 Arabidopsis root is a classic model system in plant cell and molecular biology. The sensitivity of plant roots to local environmental perturbation challenges data reproducibility and incentivizes further optimization of imaging and phenotyping tools. Here we present RoPod, an easy-to-use toolkit for low-stress live time-lapse imaging of Arabidopsis roots. RoPod comprises a dedicated protocol for plant cultivation and a customizable 3D-printed vessel with integrated microscopy-grade glass that serves simultaneously as a growth and imaging chamber. RoPod reduces impact of sample handling, preserves live samples for prolonged imaging sessions, and facilitates application of treatments during image acquisition. We describe a protocol for RoPods fabrication and provide illustrative application pipelines for monitoring root hair growth and autophagic activity. Furthermore, we showcase how the use of RoPods advanced our understanding of plant autophagy, a major catabolic pathway and a key player in plant fitness. Specifically, we obtained fine time resolution for autophagy response to commonly used chemical modulators of the pathway and revealed previously overlooked cell type-specific changes in the autophagy response. These results will aid a deeper understanding of the physiological role of autophagy and provide valuable guidelines for choosing sampling time during end-point assays currently employed in plant autophagy research.
 
+<img src=./_publication/Guichard-2024.png width=60%>
+
 ## Publication Details
 
 - **DOI**: [10.1038/s41598-024-63226-1](https://doi.org/10.1038/s41598-024-63226-1)
@@ -12,5 +14,10 @@ Arabidopsis root is a classic model system in plant cell and molecular biology.
 
 ## Data Availability
 
+The different functional designs of RoPod chambers, as well as an illustrated step-by-step protocol for their 3D printing are presented in Supplementary File S1 and Supplementary Methods. Updates of the designs and of the printing protocols depending on the model of 3D printer used are available in the dedicated GitHub repository: https://github.com/AlyonaMinina/RoPod.Hardware.
+
+The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
+
 ## License
 
+This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
diff --git a/_publication/41598_2024_63226_MOESM4_ESM.mp4 b/_publication/41598_2024_63226_MOESM4_ESM.mp4
new file mode 100644
index 0000000000000000000000000000000000000000..78133c72e2419ead91f93bc2eefdc4c4571fc453
--- /dev/null
+++ b/_publication/41598_2024_63226_MOESM4_ESM.mp4
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:646c1d643a0017469c297f170f2d21010466896f81021166bd802ded1090d297
+size 26176666
diff --git a/_publication/41598_2024_63226_MOESM5_ESM.pdf b/_publication/41598_2024_63226_MOESM5_ESM.pdf
new file mode 100644
index 0000000000000000000000000000000000000000..9b45406610f7285bbd858cce5f8739cdad1973c6
--- /dev/null
+++ b/_publication/41598_2024_63226_MOESM5_ESM.pdf
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:a10015e40dd891188c6d8e6d62bf3b37dc0923bdbfed277a680138c3c0058a55
+size 1836808
diff --git a/_publication/41598_2024_63226_MOESM7_ESM.zip b/_publication/41598_2024_63226_MOESM7_ESM.zip
new file mode 100644
index 0000000000000000000000000000000000000000..28daada595797b8e1f2d285b8cb49218dee3ac69
Binary files /dev/null and b/_publication/41598_2024_63226_MOESM7_ESM.zip differ
diff --git a/_publication/41598_2024_63226_MOESM8_ESM.zip b/_publication/41598_2024_63226_MOESM8_ESM.zip
new file mode 100644
index 0000000000000000000000000000000000000000..2f2006cc8aef30e49576d85684b3ea5a08de30eb
--- /dev/null
+++ b/_publication/41598_2024_63226_MOESM8_ESM.zip
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:91fec689097617ecdd8470fb23bbfbfd40e1e42f589f2e631ceceef644348c87
+size 12447271
diff --git a/_publication/41598_2024_63226_MOESM9_ESM.zip b/_publication/41598_2024_63226_MOESM9_ESM.zip
new file mode 100644
index 0000000000000000000000000000000000000000..7b6853438148f83848e694fcff6e6b17dacc107a
Binary files /dev/null and b/_publication/41598_2024_63226_MOESM9_ESM.zip differ
diff --git a/_publication/Guichard-2024.png b/_publication/Guichard-2024.png
new file mode 100644
index 0000000000000000000000000000000000000000..32404348b19efdbd5243d653dd02c9bc733aad7d
Binary files /dev/null and b/_publication/Guichard-2024.png differ
diff --git a/_publication/README.md b/_publication/README.md
new file mode 100644
index 0000000000000000000000000000000000000000..6c257bdfa8c4c5e00150abd9aea6ee0e42ed599e
--- /dev/null
+++ b/_publication/README.md
@@ -0,0 +1,21 @@
+## Supplementary Information
+
+**Supplementary Figures and Methods**
+
+https://static-content.springer.com/esm/art%3A10.1038%2Fs41598-024-63226-1/MediaObjects/41598_2024_63226_MOESM5_ESM.pdf
+
+**Supplementary File S1**
+
+https://static-content.springer.com/esm/art%3A10.1038%2Fs41598-024-63226-1/MediaObjects/41598_2024_63226_MOESM6_ESM.zip
+
+**Supplementary Files S2-8**
+
+https://static-content.springer.com/esm/art%3A10.1038%2Fs41598-024-63226-1/MediaObjects/41598_2024_63226_MOESM7_ESM.zip
+
+**Supplementary File S9**
+
+https://static-content.springer.com/esm/art%3A10.1038%2Fs41598-024-63226-1/MediaObjects/41598_2024_63226_MOESM8_ESM.zip
+
+**Supplementary File S10**
+
+https://static-content.springer.com/esm/art%3A10.1038%2Fs41598-024-63226-1/MediaObjects/41598_2024_63226_MOESM9_ESM.zip
\ No newline at end of file
diff --git a/_publication/s41598-024-63226-1.pdf b/_publication/s41598-024-63226-1.pdf
new file mode 100644
index 0000000000000000000000000000000000000000..11ccc8f26b9de8f999393a2d8e3d38b340bb8c3d
--- /dev/null
+++ b/_publication/s41598-024-63226-1.pdf
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:142234ea41a076b00f46701b44213b8678312a78ec30fbd0810cce4b3947fe02
+size 6260283
diff --git a/assays/AutophagicActivityAssay/README.md b/assays/AutophagicActivityAssay/README.md
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/AutophagicActivityAssay/dataset/.gitkeep b/assays/AutophagicActivityAssay/dataset/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/AutophagicActivityAssay/dataset/41598_2024_63226_Fig5_HTML.webp b/assays/AutophagicActivityAssay/dataset/41598_2024_63226_Fig5_HTML.webp
new file mode 100644
index 0000000000000000000000000000000000000000..813d6dbcaabc3c4683c96cbe4534a1e9d9637851
--- /dev/null
+++ b/assays/AutophagicActivityAssay/dataset/41598_2024_63226_Fig5_HTML.webp
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:c2dfebfbedfaee088247cfd39895c87ae901bdaa05f4c214b431f0b5d2696f63
+size 706856
diff --git a/assays/AutophagicActivityAssay/dataset/41598_2024_63226_MOESM3_ESM.mp4 b/assays/AutophagicActivityAssay/dataset/41598_2024_63226_MOESM3_ESM.mp4
new file mode 100644
index 0000000000000000000000000000000000000000..b25525520327abbb0d930aa285cf9f5b872face2
--- /dev/null
+++ b/assays/AutophagicActivityAssay/dataset/41598_2024_63226_MOESM3_ESM.mp4
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:2aacc0043424e4a9a52ec10f2c3c836a5d1dcc1bc9be2c21cb1f892da3ba4118
+size 6662251
diff --git a/assays/AutophagicActivityAssay/dataset/FigS1.png b/assays/AutophagicActivityAssay/dataset/FigS1.png
new file mode 100644
index 0000000000000000000000000000000000000000..0728f0e3fb20f0347b57d13e9c0db14180e73550
--- /dev/null
+++ b/assays/AutophagicActivityAssay/dataset/FigS1.png
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:d15e32dd64c18064624bc5318d96351cfe0d722224612b9a4c607521cd9e479b
+size 76781
diff --git a/assays/AutophagicActivityAssay/dataset/FigS2.png b/assays/AutophagicActivityAssay/dataset/FigS2.png
new file mode 100644
index 0000000000000000000000000000000000000000..80c0f948d149ad9b1d535366b18012b13e0a04b6
--- /dev/null
+++ b/assays/AutophagicActivityAssay/dataset/FigS2.png
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:2662a72db6fc64a669bed23a2f9fd8560610cf0d9f2a0730cd5552c699429a65
+size 246922
diff --git a/assays/AutophagicActivityAssay/isa.assay.xlsx b/assays/AutophagicActivityAssay/isa.assay.xlsx
new file mode 100644
index 0000000000000000000000000000000000000000..eb35e1b286f8f5a2f4cdef7fe69bb6efa87daa0f
Binary files /dev/null and b/assays/AutophagicActivityAssay/isa.assay.xlsx differ
diff --git a/assays/AutophagicActivityAssay/protocols/.gitkeep b/assays/AutophagicActivityAssay/protocols/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/AutophagicActivityAssay/protocols/Autophagic-Activity.md b/assays/AutophagicActivityAssay/protocols/Autophagic-Activity.md
new file mode 100644
index 0000000000000000000000000000000000000000..b32d6961fed22858bd9a8b7c054dbcd6a745ddd6
--- /dev/null
+++ b/assays/AutophagicActivityAssay/protocols/Autophagic-Activity.md
@@ -0,0 +1,14 @@
+## Autophagic activity assay
+
+Growth medium (0.5 × MS (Duchefa, ref. M0222); MES 10 mM (Duchefa, ref. M1503); 1% sucrose; pH 5.8; 0.8% Plant agar (Duchefa, ref. P1001)) was autoclaved for 20 min at 120 °C, cooled to approximatively 60 °C and pipetted under sterile conditions into either 4–wells Ibidi coverslips (cat # 80,421 #1.5 polymer coverslip, hydrophobic, sterilized, Ibidi, Germany) for the experiment presented in Fig. 5 or into RoPod v24 for the experiment presented in Supplementary figure S2. 1 ml of medium was used per well of Ibidi chamber and 4 ml were used for the RoPod v24. 
+
+*Arabidopsis thaliana* seeds were surface sterilized in 70% EtOH, 0.05% TritonX-100 for 20 min, washed three times with 96% EtOH, air dried in a sterile bench and transferred into the chambers using a sterile toothpick. The chambers were then placed under long day growth conditions (16 h, 150 µmol m−2.s−1 light at 22 °C, 8 h dark
+at 20 °C). Typically, for the first four days the chambers were kept horizontally allowing the roots to reach the bottom cover slip. After this, the chambers were placed vertically to guide the root growth along the cover slip.
+
+Chemical compounds were diluted in 0.5 × MS liquid medium (the same composition as the growth medium, but lacking Plant agar) to a final concentration of 1 µM AZD8055 (Sigma, ref. ADV465749178, CAS number 1009298-09-2), 1 µM ConA (Sigma, ref. C9705, CAS number 80890-47-7) or 0.1% DMSO for the vehicle control. The solutions were pipetted into the wells of the chambers mounted on the confocal stage in 1:1 ratio (1 volume of the medium in the well: 1 volume of the drug solution. Drug final concentration: 500 nM) right before the start of imaging.
+
+Imaging was performed using CLSM Leica SP5 or SP8 (Leica Microsystems, Germany), 63× water immersion objective, NA = 1.2, excitation light 488 nm, emission range of 498–541 nm and system-optimized pinhole size or and Zeiss CLSM 800 Objective 40x/1.2W and similar scanning settings. For this study, pHusion tag was used solely as a fluorescent reporter and ot as a pH indicator. Four to six biological replicates were imaged for wildtype and *atg* KO backgrounds in each experiment. The experiment was performed four times in two independent laboratories. Images were acquired at the beginning of the root differentiation zone, collecting approximatively 100 µm deep z-stack starting at the surface of a root (pixel dimensions 0.29 µm.px−1, image size 848 × 848 px, 8-bit). Each replicate was imaged every 10 to 28 min for a period of 12 to 18 h.
+
+Images in Fig. 5 were analyzed with *Fiji* and Ilastik44. The detailed protocol and the macro used for the analysis are presented in the Supplementary File S3 and Supplementary Methods. The number of vesicles was counted for each cell file type using data obtained from two independent experiments. 1 to 5 roots and 2 to 15 cell files per type were analyzed in total. The fluorescence intensity was measured for each vesicle counted, for a total population per cell file of 8 to 2339 vesicles, depending on the genotype, the treatment, the cell file type and the time of the record considered. The mean intensity has been corrected with the background signal and normalized to the first time point of the record. As the image acquisition rate varied between experiments due to different number of biological replicates, each presented time point actually corresponds to an interval of up to 15 min. 
+
+For quantification of autophagic bodies in the complete cell volume, seeds of the transgenic line co-expressing spL-RFP and GFP-ATG8a were sterilized using the above described Chlorin method and plated either on Petri plates or in the RoPod v24. 5 days old seedlings were treated with concanamycin A for 12 h as described above and imaged using Zeiss CLSM 800 Objective 40x/1.2W to obtain tiled, z-stack encompassing complete root hair cells. Puncta quantification was performed using *Fiji* and dedicated macro as described in the Supplementary File S4.
\ No newline at end of file
diff --git a/assays/ComparisonOfAutophagicActivityInRoots/README.md b/assays/ComparisonOfAutophagicActivityInRoots/README.md
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/ComparisonOfAutophagicActivityInRoots/dataset/.gitkeep b/assays/ComparisonOfAutophagicActivityInRoots/dataset/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/ComparisonOfAutophagicActivityInRoots/dataset/41598_2024_63226_Fig2_HTML.webp b/assays/ComparisonOfAutophagicActivityInRoots/dataset/41598_2024_63226_Fig2_HTML.webp
new file mode 100644
index 0000000000000000000000000000000000000000..6a93afe4a7ca1a0026ae5ba56eaac31e720e7c87
--- /dev/null
+++ b/assays/ComparisonOfAutophagicActivityInRoots/dataset/41598_2024_63226_Fig2_HTML.webp
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:b647d3887d36ad3d8ded2fd114e9493b40fbe26049e4eb31a5017160dd9128fd
+size 218878
diff --git a/assays/ComparisonOfAutophagicActivityInRoots/isa.assay.xlsx b/assays/ComparisonOfAutophagicActivityInRoots/isa.assay.xlsx
new file mode 100644
index 0000000000000000000000000000000000000000..077038a7acd98df137b4ce2bfd13b193fc6177ff
Binary files /dev/null and b/assays/ComparisonOfAutophagicActivityInRoots/isa.assay.xlsx differ
diff --git a/assays/ComparisonOfAutophagicActivityInRoots/protocols/.gitkeep b/assays/ComparisonOfAutophagicActivityInRoots/protocols/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/ComparisonOfAutophagicActivityInRoots/protocols/Comparison-Of-Autophagic-Activity-In-Roots.md b/assays/ComparisonOfAutophagicActivityInRoots/protocols/Comparison-Of-Autophagic-Activity-In-Roots.md
new file mode 100644
index 0000000000000000000000000000000000000000..4deef55571ade9d33fdc5ea6eea6ddd840b6f783
--- /dev/null
+++ b/assays/ComparisonOfAutophagicActivityInRoots/protocols/Comparison-Of-Autophagic-Activity-In-Roots.md
@@ -0,0 +1,3 @@
+## Comparison of autophagic activity in roots mounted on glass or in RoPods
+
+To assess the impact of glass-based sample mounting on the autophagic activity, RoPod v24 and standard agar plates were prepared similarly to the experiment for the root length measurement. After 6 days, seedlings growing on top of the agar medium were transferred in an empty glass bottom chamber, on a drop of 0.5 × MS and then gently covered with a cover slide. To prevent fast evaporation of the liquid medium, the glass bottom chamber was covered with a lid. Both RoPod v24 with seedlings and glass bottom chamber with transferred seedlings were imaged at different end points using CLSM 800 (Carl Zeiss), Objective 40x/1.2W, excitation light 488 nm, and emission 505–560 nm. The number of puncta was quantified in *Fiji* using the workflow presented in Supplementary File S2.
\ No newline at end of file
diff --git a/assays/FluoresceinDiffusionAssay/README.md b/assays/FluoresceinDiffusionAssay/README.md
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/FluoresceinDiffusionAssay/dataset/.gitkeep b/assays/FluoresceinDiffusionAssay/dataset/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/FluoresceinDiffusionAssay/dataset/41598_2024_63226_Fig3_HTML.webp b/assays/FluoresceinDiffusionAssay/dataset/41598_2024_63226_Fig3_HTML.webp
new file mode 100644
index 0000000000000000000000000000000000000000..a43aec301ff56dc002c3e40a733ddbf62d52bf90
--- /dev/null
+++ b/assays/FluoresceinDiffusionAssay/dataset/41598_2024_63226_Fig3_HTML.webp
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:2ef3f7ea8cbc09b8e931a9d605280ab9da20b1b5c2efe51dfc9d301cd8166f72
+size 116426
diff --git a/assays/FluoresceinDiffusionAssay/isa.assay.xlsx b/assays/FluoresceinDiffusionAssay/isa.assay.xlsx
new file mode 100644
index 0000000000000000000000000000000000000000..062a68bd507f428bb0be72bf9f495576b5ae708c
Binary files /dev/null and b/assays/FluoresceinDiffusionAssay/isa.assay.xlsx differ
diff --git a/assays/FluoresceinDiffusionAssay/protocols/.gitkeep b/assays/FluoresceinDiffusionAssay/protocols/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/FluoresceinDiffusionAssay/protocols/Fluorescein-Diffusion-Assay.md b/assays/FluoresceinDiffusionAssay/protocols/Fluorescein-Diffusion-Assay.md
new file mode 100644
index 0000000000000000000000000000000000000000..ff264a43fffa58343c07c437feabba0f1885145a
--- /dev/null
+++ b/assays/FluoresceinDiffusionAssay/protocols/Fluorescein-Diffusion-Assay.md
@@ -0,0 +1,5 @@
+## Fluorescein diffusion assay
+
+To assess diffusion of chemical compounds within RoPod chambers containing plants, Arabidopsis Col-0 seeds were surface sterilized in opened 2 ml tubes for 2 h in an air-tight box containing chlorine gas, produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas. Seeds were then transferred, with a sterile toothpick, in 2-wells Ibidi chambered coverslips (cat # 80,286 #1.5 polymer coverslip, hydrophobic, sterilized, Ibidi, Germany) filled with 1 mL of growth medium in each well (0.5 × MS (Serva, ref. 47,515); MES 5 mM (Sigma, ref. M8250); 1% sucrose; pH 5.7 adjusted with KOH; 0.8% Plant agar (Duchefa, ref. M1002). As the height of the Ibidi chamber is too small to accommodate nine days old seedlings, the seeds were put on the surface of the agar to be first cultivated for eight days horizontally at 21 °C, 16 h illumination, 100 µmol m−2.s−1, until the root penetrate the agar and reached the glass bottom. Then, the RoPods were incubated at 45° angle for one day before image acquisition. At the start of the recording, each well containing plants was filled with 1 ml of fluorescein at 4 μg.ml-1 diluted in a liquid 0.5 × MS (final concentration after diffusion: 2 µg.ml−1). Imaging was performed using Leica DMI8 confocal microscope and HC PL APO CS2 20 × objective (excitation, 488 nm, emission, 498–550 nm, pinhole size of 1 Airy Unit) (Leica Microsystems, Germany), pixel dimensions 0.48 µm px−1, image size 512 × 512 px, 8-bit. The root hairs that were growing at the beginning of the recording were selected for analysis. To obtain a complete view of the root hairs, a z-stack was performed to cover 92 µm height with each section separated with 10 µm. The images were then processed on *Fiji* to obtain maximum intensity projection. A circular region of interest (ROI) with a 12 µm diameter was used to measure the mean grey value on the selected root hair tips, on the base of the corresponding root hair tip and in the upper left corner of the image for the mean grey value of background. The experiment was performed in two individual boxes containing 2 to 3 roots each, 2 to 8 root hairs analyzed per root.
+
+For the fluorescein diffusion assay in the solid medium and without plants, 2-wells Ibidi chambers filled with 1 ml of the same 0.5 × MS agar in each well. 1 ml of liquid growth medium supplemented with 140 µg.ml−1 of fluorescein solution was added at the start of the recording (final concentration after diffusion: 70 µg.ml−1). The same microscope settings as for the previous diffusion assay were used (pixel dimensions 1.14 µm.px−1, image size 512 × 512 px, 8-bit). The fluorescence was recorded in 4 RoPods, with 2 to 3 fields of view chosen at random positions in each box. *Fiji* software was used for image analysis. An orthogonal projection was carried out in the middle of each acquisition area with the Orthogonal view tool. To define the bottom of the RoPod, the orthogonal view of the image acquired 2 h after the start of treatment was used. A rectangular ROI with the width of the orthogonal projection image and 10 µm in height was drawn at the bottom of the RoPod chamber. This ROI was reused to measure the mean grey value on the orthogonal view for each time point recorded at the same location.
\ No newline at end of file
diff --git a/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/README.md b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/README.md
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/dataset/.gitkeep b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/dataset/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/dataset/41598_2024_63226_Fig4_HTML.webp b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/dataset/41598_2024_63226_Fig4_HTML.webp
new file mode 100644
index 0000000000000000000000000000000000000000..b97b77c4e9dedf63e57904dc13ffc3700ebb9b25
--- /dev/null
+++ b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/dataset/41598_2024_63226_Fig4_HTML.webp
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:13bf042cd3a0ded890341af1506b405fc75de955013a8ab34cf7a56f2be290ed
+size 377286
diff --git a/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/dataset/41598_2024_63226_MOESM2_ESM.mp4 b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/dataset/41598_2024_63226_MOESM2_ESM.mp4
new file mode 100644
index 0000000000000000000000000000000000000000..32fbbc36550d743d7f1c3b977db2029c031bee1c
--- /dev/null
+++ b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/dataset/41598_2024_63226_MOESM2_ESM.mp4
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:03bf1372f080526ace36dc00cab3e18196f50e3a6075983c4a73012a0e496320
+size 628445
diff --git a/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/isa.assay.xlsx b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/isa.assay.xlsx
new file mode 100644
index 0000000000000000000000000000000000000000..ef51a907b0846be1807b780f25c13be82be454fa
Binary files /dev/null and b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/isa.assay.xlsx differ
diff --git a/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/protocols/.gitkeep b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/protocols/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/protocols/Image-Analysis-Of-Sucrose-Treatment.md b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/protocols/Image-Analysis-Of-Sucrose-Treatment.md
new file mode 100644
index 0000000000000000000000000000000000000000..3002c800650afea87700699f0c090e5e750c7c1a
--- /dev/null
+++ b/assays/PlantGrowthAndImageAnalysisOfSucroseTreatmentAssay/protocols/Image-Analysis-Of-Sucrose-Treatment.md
@@ -0,0 +1,3 @@
+## Plant growth and image analysis of sucrose treatment assay
+
+*Arabidopsis thaliana* Col-0 wild-type seeds were surface sterilized with the chlorine gas method (see the Fluorescein section of Material and methods). The seedlings were grown in sterile RoPod v5 chambers containing 3 ml of solid growth medium (0.5 × MS (Serva, ref. 47,515); MES 5 mM (Sigma, ref. M8250); pH 5.7 adjusted with KOH; 0.8% Plant agar (Duchefa, ref. M1002)), as described in Supplementary Methods. The injection hole of the RoPod v5 was closed with micropore tape. The chambers were placed into a 12 × 12 cm dish, and positioned with an angle of 45° into a plant growth cabinet with side illumination, 16 h light, 20 °C for six days. The recording was made using a 90°-flipped microscope for vertical specimen mounting (Zeiss AxioVert 200M, ITK MMS-100 linear stage and Hydra controller, Hamatsu OrcaC11440-36U camera, Zeiss 10 × PlanNeoFluar objective). LED bulb compatible for plant culture (LED power 150W, Chip SMD2835, 215 pcs Warm, 40pcs Red, 5pcs blue) was set to illumination intensity of 100 µmol m−2.s−1 measured at the proximity of the RoPod). Tubing connected to a syringe was inserted into the injection hole and taped on the microscope prior to imaging start in order to limit the vibration during injection. Two RoPod v5 were mounted at the same time on the microscope. A basal line was recorded for 4 h for both control and treated samples. Then, 8 ml of 0.5 × MS liquid supplemented with 1% sucrose were added in one of the RoPods (final concentration: 0.8%) and control specimen were treated with 8 ml of 0.5 × MS without sucrose. Root hair growth was recorded for an additional 8 h. For each root, two consecutive XY fields of view were recorded to obtain images of the root hairs at different stages of development throughout the recording time (pixel dimensions 0.92 µm.px−1, image size 1200 × 1920 px, 16-bit). In addition, a Z-stack encompassing 240 µm with optical sections of 30 µm was carried out to obtain a clear view of the entire root hairs. Finally, an image was recorded every 8 min. The images were analyzed with Fiji software. The detailed method illustrated with figures, the macros used for the analysis, as well as a tutorial video to use those macros are available in the Supplementary Methods, Figure S3, File S5–8 and Movie S4. To test these macros, an example image is provided in the Supplementary File S9. The data produced by *Fiji* were analyzed using *R studio* software. The scripts used for the analysis are available in the Supplementary File S10.
\ No newline at end of file
diff --git a/assays/RootLengthMeasurement/README.md b/assays/RootLengthMeasurement/README.md
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/RootLengthMeasurement/dataset/.gitkeep b/assays/RootLengthMeasurement/dataset/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/RootLengthMeasurement/dataset/41598_2024_63226_MOESM1_ESM.mp4 b/assays/RootLengthMeasurement/dataset/41598_2024_63226_MOESM1_ESM.mp4
new file mode 100644
index 0000000000000000000000000000000000000000..ac4e5249e562bf14336b49f3a467f1ac0f09e249
--- /dev/null
+++ b/assays/RootLengthMeasurement/dataset/41598_2024_63226_MOESM1_ESM.mp4
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:3e9f8a810639aef59325dd7990a2c66c33c8ad080b2ef2e579474625fa8fca3a
+size 3116283
diff --git a/assays/RootLengthMeasurement/dataset/Figure1g-i.png b/assays/RootLengthMeasurement/dataset/Figure1g-i.png
new file mode 100644
index 0000000000000000000000000000000000000000..e6942185f56c665edd7ad962d828efd917ab675f
--- /dev/null
+++ b/assays/RootLengthMeasurement/dataset/Figure1g-i.png
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:bae9d7207e09adf96720ccbaf343936a64e61e6e7de05dca2fdfa4f81f64fcf9
+size 633410
diff --git a/assays/RootLengthMeasurement/isa.assay.xlsx b/assays/RootLengthMeasurement/isa.assay.xlsx
new file mode 100644
index 0000000000000000000000000000000000000000..a2d2f392ad48597e2be1cc979bac565e0804e64e
Binary files /dev/null and b/assays/RootLengthMeasurement/isa.assay.xlsx differ
diff --git a/assays/RootLengthMeasurement/protocols/.gitkeep b/assays/RootLengthMeasurement/protocols/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/assays/RootLengthMeasurement/protocols/Root-Lenth-Measurement.md b/assays/RootLengthMeasurement/protocols/Root-Lenth-Measurement.md
new file mode 100644
index 0000000000000000000000000000000000000000..a5b5f1fcfc447ef6841ff8009d8299c31772b29e
--- /dev/null
+++ b/assays/RootLengthMeasurement/protocols/Root-Lenth-Measurement.md
@@ -0,0 +1,3 @@
+ ## Root length measurement for seedlings grown in RoPods and on standard Petri plates
+
+To compare the root growth phenotypes for seedlings grown in RoPods and in standard Petri plates, 4 ml of growth medium (0.5 × MS (*Duchefa*, ref. M0222); MES 10 mM (*Duchefa*, ref. M1503); 1% sucrose; pH 5.8; 0.8% Plant agar (*Duchefa*, ref. P1001) were pipetted into each sterile RoPod v24 and 40 ml were poured into 12cmx12cm plates. A strip of the medium was removed from the RoPods or plates using a sterile scalpel. Seeds of GFP-ATG8 expressing lines were sterilized using chlorin method (incubated in 10% Chlorin; 0.001% Tween-20 for 20 min then washed 6 times with sterile water) and then plated into RoPod v24, or in standard plate, either on the edge between the agar and plastic plate bottom or on top of the agar. Three RoPod v24 were placed into a 12 cm square empty plates. Both standard agar plate and plate loaded with RoPod24 were mounted on the automated imaging platform SPIRO (Ohlsson, J. A. et al., 2021) and imaged every hour for seven days under 16h illumination (Day imaging settings: ISO 50, shutter speed 65; Night imaging settings: ISO 250 Shutter speed 10). The root length was measured manually on obtained images using *Fiji* software (ImageJ 1.53t) (Schindelin, J. et al., 2012).
\ No newline at end of file
diff --git a/isa.investigation.xlsx b/isa.investigation.xlsx
index 67ec77b927d86478f50f99218271735635fbcf0b..315e788ed32c08d69e69159ec50ffc8c57204b5c 100644
Binary files a/isa.investigation.xlsx and b/isa.investigation.xlsx differ
diff --git a/studies/GeneticConstructs/README.md b/studies/GeneticConstructs/README.md
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/GeneticConstructs/isa.study.xlsx b/studies/GeneticConstructs/isa.study.xlsx
new file mode 100644
index 0000000000000000000000000000000000000000..c90c0926e119514a6ded5a2ad1be1379610e4f4b
Binary files /dev/null and b/studies/GeneticConstructs/isa.study.xlsx differ
diff --git a/studies/GeneticConstructs/protocols/.gitkeep b/studies/GeneticConstructs/protocols/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/GeneticConstructs/protocols/Genetic-constructs.md b/studies/GeneticConstructs/protocols/Genetic-constructs.md
new file mode 100644
index 0000000000000000000000000000000000000000..5517e538dd3cd4a501dd8f1e2a31fe80ab3bc27f
--- /dev/null
+++ b/studies/GeneticConstructs/protocols/Genetic-constructs.md
@@ -0,0 +1,5 @@
+## Genetic Constructs
+
+pMDC pHusion 1 Gateway vector was generated by amplifying pHusion tag from the p16:SYP61-pHusion construct (Jain, A. et al., 2007) using primers TTGGTACCATGGCCTCCTCCGAGGACG and TTGGCGCGCCCCCCTTGTACAGCTCGTCCATG and introducing amplicon into pMDC32 vector (Schindelin, J. et al., 2012) via KpnI/AscI restriction digestion sites.
+
+AtATG8a CDS Gateway entry clone (Dauphinee, A. N. et al., 2019) was then recombined with the pMDC pHusion 1 Gateway vector to obtain the construct driving expression of pHusion-AtATG8a under control of double 35S promoter.
\ No newline at end of file
diff --git a/studies/GeneticConstructs/resources/.gitkeep b/studies/GeneticConstructs/resources/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/PlantGrowth/README.md b/studies/PlantGrowth/README.md
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/PlantGrowth/isa.study.xlsx b/studies/PlantGrowth/isa.study.xlsx
new file mode 100644
index 0000000000000000000000000000000000000000..f7b22fc599db10ecd42259a683ffa65f19f65066
Binary files /dev/null and b/studies/PlantGrowth/isa.study.xlsx differ
diff --git a/studies/PlantGrowth/protocols/.gitkeep b/studies/PlantGrowth/protocols/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/PlantGrowth/protocols/Protocol-Growth.md b/studies/PlantGrowth/protocols/Protocol-Growth.md
new file mode 100644
index 0000000000000000000000000000000000000000..e0611458cf199fafc0b64a469aa02e5f8407c0b4
--- /dev/null
+++ b/studies/PlantGrowth/protocols/Protocol-Growth.md
@@ -0,0 +1,3 @@
+## Plant Growth Protocol Overview
+
+The recommended protocol to grow seedlings in RoPods is presented in the Supplementary Methods. To reuse the chambers, the growth medium was gently removed using a Q-tip, the chambers were washed with cold water and dish soap, or in 1% SDS, abundantly rinsed with tap water followed by rinsing with MilliQ water, air dried and sterilized for 1 h under UV light. Alternatively, chambers were sterilized by incubating for 40 min in 70% ethanol, followed by overnight drying in the sterile bench.
\ No newline at end of file
diff --git a/studies/PlantGrowth/resources/.gitkeep b/studies/PlantGrowth/resources/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/PlantMaterial/README.md b/studies/PlantMaterial/README.md
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/PlantMaterial/isa.study.xlsx b/studies/PlantMaterial/isa.study.xlsx
new file mode 100644
index 0000000000000000000000000000000000000000..490a236e282e1bc446790cd176b7a01a441df3db
Binary files /dev/null and b/studies/PlantMaterial/isa.study.xlsx differ
diff --git a/studies/PlantMaterial/protocols/.gitkeep b/studies/PlantMaterial/protocols/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/PlantMaterial/protocols/Plant-Material.md b/studies/PlantMaterial/protocols/Plant-Material.md
new file mode 100644
index 0000000000000000000000000000000000000000..fafe3d16d69f54f0eb42ce4f67fa7052ebd83334
--- /dev/null
+++ b/studies/PlantMaterial/protocols/Plant-Material.md
@@ -0,0 +1,9 @@
+## Plant Material
+
+Autophagy deficient *atg5/atg7* double knockout line was established by crossing previously published *atg5-1* (Thomson et al., 2005) and *atg7-2* (Hofius, D. et al., 2009) mutants.
+
+Col-0 wild-type and *atg5/atg7* plants were transformed using GV3101 strain of Agrobacterium tumefaciens carrying pMDC pHusion1 AtATG8a construct as described in (Dauphinee, A. N. et al., 2019).
+
+Col-0 WT and *atg5-1* plants expressing GFP-ATG8a line was described previously (Minina, E. A. et al.,2018), (Thomson et al., 2005).
+
+Col-0 WT plants co-expressing vacuolar marker spL-RFP and the autophagosomal marker GFP-ATG8a were obtained by crossing the corresponding marker lines previously published in Hunter et al. ( Hunter et al., 2007) and Thomson et al. (Thomson et al., 2005).
\ No newline at end of file
diff --git a/studies/PlantMaterial/resources/.gitkeep b/studies/PlantMaterial/resources/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/RoPodChamberPrinting/README.md b/studies/RoPodChamberPrinting/README.md
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/RoPodChamberPrinting/isa.study.xlsx b/studies/RoPodChamberPrinting/isa.study.xlsx
new file mode 100644
index 0000000000000000000000000000000000000000..9b213c062a194ea52de85ac7c1d3c74ae9956aef
Binary files /dev/null and b/studies/RoPodChamberPrinting/isa.study.xlsx differ
diff --git a/studies/RoPodChamberPrinting/protocols/.gitkeep b/studies/RoPodChamberPrinting/protocols/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/RoPodChamberPrinting/protocols/RoPod-Chamber-Printing.md b/studies/RoPodChamberPrinting/protocols/RoPod-Chamber-Printing.md
new file mode 100644
index 0000000000000000000000000000000000000000..1eeacea3b57411bfc56ebeaab66a8818d12c7dc2
--- /dev/null
+++ b/studies/RoPodChamberPrinting/protocols/RoPod-Chamber-Printing.md
@@ -0,0 +1,7 @@
+## RoPod Chamber Printing
+
+In this study we firstly tested five types of microscopy coverslip bottom chambers from three different providers: Ibidi chambered coverslips (cat # 80,421 and 80,286 #1.5 polymer coverslip, hydrophobic, sterilized, Ibidi, Germany), 1-well II Chamber Slideâ„¢ System (Nuncâ„¢ Lab-Tekâ„¢, cat # C6307, Sigma-Aldrich), x-well cell culture chamber, 1-well, on coverglass (cat # 94.6190.102, Sarstedt). Plants in these chambers were grown using the same protocol as was later implemented for the custom designed chambers (Supplementary Methods).
+
+The different functional designs of RoPod chambers, as well as an illustrated step-by-step protocol for their 3D printing are presented in Supplementary File S1 and Supplementary Methods. Updates of the designs and of the printing protocols depending on the model of 3D printer used are available in the dedicated GitHub repository: https://github.com/AlyonaMinina/RoPod.Hardware.
+
+Printing of the chambers was tested using Prusa MK2.5S, MK3S, MK3S+ , MINI+ and Ultimaker S5 3D printers. We recommend using clear PETG filaments provided by Prusament, Sunlu or Prima Select
\ No newline at end of file
diff --git a/studies/RoPodChamberPrinting/resources/.gitkeep b/studies/RoPodChamberPrinting/resources/.gitkeep
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/studies/RoPodChamberPrinting/resources/41598_2024_63226_MOESM6_ESM.zip b/studies/RoPodChamberPrinting/resources/41598_2024_63226_MOESM6_ESM.zip
new file mode 100644
index 0000000000000000000000000000000000000000..7d6dda8f9812717ca58d54d03ed937fc522b541d
--- /dev/null
+++ b/studies/RoPodChamberPrinting/resources/41598_2024_63226_MOESM6_ESM.zip
@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:1154a1e8129766e9528eb360825098c113fa8a857104de08a8f8751d4e6a281b
+size 2982426