diff --git a/assays/AbsoluteQuantificationOfBacteria/README.md b/assays/AbsoluteQuantificationOfBacteria/README.md new file mode 100644 index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391 diff --git a/assays/AbsoluteQuantificationOfBacteria/dataset/.gitkeep b/assays/AbsoluteQuantificationOfBacteria/dataset/.gitkeep new file mode 100644 index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391 diff --git a/assays/AbsoluteQuantificationOfBacteria/isa.assay.xlsx b/assays/AbsoluteQuantificationOfBacteria/isa.assay.xlsx new file mode 100644 index 0000000000000000000000000000000000000000..ed571a573bc16024ea58c94763bc62b3f91adb4e Binary files /dev/null and b/assays/AbsoluteQuantificationOfBacteria/isa.assay.xlsx differ diff --git a/assays/AbsoluteQuantificationOfBacteria/protocols/.gitkeep b/assays/AbsoluteQuantificationOfBacteria/protocols/.gitkeep new file mode 100644 index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391 diff --git a/assays/AbsoluteQuantificationOfBacteria/protocols/AbsoluteQuantificationOfBacteriaProtocol.md b/assays/AbsoluteQuantificationOfBacteria/protocols/AbsoluteQuantificationOfBacteriaProtocol.md new file mode 100644 index 0000000000000000000000000000000000000000..dae31d5bc8637b05769657b27181d1beb5a43c2e --- /dev/null +++ b/assays/AbsoluteQuantificationOfBacteria/protocols/AbsoluteQuantificationOfBacteriaProtocol.md @@ -0,0 +1,7 @@ +## Absolute quantification of bacteria + +Genomic DNA was isolated from roots of plants grown in FlowPots (experiments K and L). DNA concentration was determined with the Quant-iT PicoGreen double-stranded DNA Assay Kit (Thermo Fisher Scientific). To quantify bacterial load on plant roots, the amount of bacterial DNA relative to the amount of plant DNA was determined via quantitative PCR (qPCR). For bacteria, the v5-v7 region of the 16S rRNA gene was amplified using the AACMGGATTAGATACCCKG (799F) and ACGTCATCCCCACCTTCC (1192R) primers. For Col-0, a fragment of At1g12360 was amplified using the TCCGGTCAATATTTTTGTTCG and TATAGCAGCGAAAGCCTCGT primers, and for Gifu, a fragment of the *NFR5* gene was amplified using the TCATATGATGGAGGAGTTGTCTGTT and ATATGAGCTTCGGAGCATGG primers. qPCR was performed as described previously46. The amount of 16S rRNA was normalized to plant gene within each individual sample using the following equation: + +16S rRNA gene over plant gene = 2-Ct(16S)/2-Ct(plant). + +For colony counts (exp. E), roots were harvested, washed, weighed and crushed in 500 µl (Col-0) or 750 µl (Gifu) of sterile water. Serial dilutions of 10−1, 10−2, 10−3, 10−4 and 10−5 of the crushed roots were prepared in sterile water. Then 10 µl of each were spotted onto 10% TSB agar square plates. Single colonies were counted after 1–3 d. \ No newline at end of file