diff --git a/assays/embryo_transformation/protocols/cloning_trafo_protocol.md b/assays/embryo_transformation/protocols/cloning_trafo_protocol.md index 6e4c85e4c080edbe1acecfb0540909cf980ef95d..c4832045654e3ce22464851457ec698a7affe7b1 100644 --- a/assays/embryo_transformation/protocols/cloning_trafo_protocol.md +++ b/assays/embryo_transformation/protocols/cloning_trafo_protocol.md @@ -1,4 +1,6 @@ -**cloning** +## Transformation of barley plants + +**Cloning of transformation vectors:** - cloning of transformation vectors was performed according to the protocol by Kumar et al. (2018) - sgRNAs were cloned into recipient vector pMGE599 @@ -9,15 +11,17 @@ | 1 | 7-26, 97-116 | GGCGGTGGCGCAGCCGCGGATGG, GAGATCTATACCTACGAGGCCGG | pMGE599/7-97 | 2 | 1182-1201, 1222-1241 | GGTCAGCTACCCAGCCTGACTGG, TAATAAACTGCAGATTCTCA GGG | pMGE599/182-1222 -**transformation** +**Transformation:** -- gp-fast plants were cultivated in long-day conditions (16h day / 8 night) in control temperature (20°C / 16°C) +- GP-fast plants were cultivated in long-day conditions (16h day / 8 night) in control temperature (20°C / 16°C) - immature embryos were used for transformation according to Hensel et al. (2009) - DNA was extracted from regenerated plants using QIAGEN_DNeasy-Plant-Mini protocol - successful insertion of the transformation vector into the genome was tested by PCR using the primers Hyg-156 (5'-ACGCACAATCCCACTATCC-3') and Hyg-047 (5'-GTGTCGTCCATCACAGTTTG-3') + + +**References:** -**References** Hensel G, Kastner C, Oleszczuk S, Riechen J, Kumlehn J (2009) Agrobacterium-mediated gene transfer to cereal crop plants: Current protocols for barley, wheat, triticale, and maize. International Journal of Plant Genomics, 2009: 835608. Kumar N, Galli M, Ordon J, Stuttmann J, Kogel K-H, Imani J (2018) Further analysis of barley MORC1 using a highly efficient RNA-guided Cas9 gene-editing system. Plant Biotechnology Journal, 16(11): 1892–1903. \ No newline at end of file