From aefb554880ed1724e6db9b6212f974d2de116da0 Mon Sep 17 00:00:00 2001
From: Gesa Helmsorig <gesa.helmsorig@hhu.de>
Date: Wed, 13 Nov 2024 12:54:01 +0000
Subject: [PATCH] Update file cloning_trafo_protocol.md

---
 .../protocols/cloning_trafo_protocol.md              | 12 ++++++++----
 1 file changed, 8 insertions(+), 4 deletions(-)

diff --git a/assays/embryo_transformation/protocols/cloning_trafo_protocol.md b/assays/embryo_transformation/protocols/cloning_trafo_protocol.md
index 6e4c85e..c483204 100644
--- a/assays/embryo_transformation/protocols/cloning_trafo_protocol.md
+++ b/assays/embryo_transformation/protocols/cloning_trafo_protocol.md
@@ -1,4 +1,6 @@
-**cloning**
+## Transformation of barley plants
+
+**Cloning of transformation vectors:**
 
 - cloning of transformation vectors was performed according to the protocol by Kumar et al. (2018)
 - sgRNAs were cloned into recipient vector pMGE599
@@ -9,15 +11,17 @@
 | 1 | 7-26, 97-116 | GGCGGTGGCGCAGCCGCGGATGG, GAGATCTATACCTACGAGGCCGG |  pMGE599/7-97
 | 2 | 1182-1201, 1222-1241 | GGTCAGCTACCCAGCCTGACTGG, TAATAAACTGCAGATTCTCA GGG |  pMGE599/182-1222
 
-**transformation**
+**Transformation:**
 
-- gp-fast plants were cultivated in long-day conditions (16h day / 8 night) in control temperature (20°C / 16°C)
+- GP-fast plants were cultivated in long-day conditions (16h day / 8 night) in control temperature (20°C / 16°C)
 - immature embryos were used for transformation according to Hensel et al. (2009)
 - DNA was extracted from regenerated plants using QIAGEN_DNeasy-Plant-Mini protocol
 - successful insertion of the transformation vector into the genome was tested by PCR using the primers Hyg-156 (5'-ACGCACAATCCCACTATCC-3') and Hyg-047 (5'-GTGTCGTCCATCACAGTTTG-3')
+ 
+
 
+**References:**
 
-**References**
 Hensel G, Kastner C, Oleszczuk S, Riechen J, Kumlehn J (2009) Agrobacterium-mediated gene transfer to cereal crop plants: Current protocols for barley, wheat, triticale, and maize. International Journal of Plant Genomics, 2009: 835608.
 
 Kumar N, Galli M, Ordon J, Stuttmann J, Kogel K-H, Imani J (2018) Further analysis of barley MORC1 using a highly efficient RNA-guided Cas9 gene-editing system. Plant Biotechnology Journal, 16(11): 1892–1903.
\ No newline at end of file
-- 
GitLab