add genetic constructs study and protocol

studies/GeneticConstructs/protocols/Genetic-constructs.md

+## Genetic Constructs
+
+pMDC pHusion 1 Gateway vector was generated by amplifying pHusion tag from the p16:SYP61-pHusion construct (Jain, A. et al., 2007) using primers TTGGTACCATGGCCTCCTCCGAGGACG and TTGGCGCGCCCCCCTTGTACAGCTCGTCCATG and introducing amplicon into pMDC32 vector (Schindelin, J. et al., 2012) via KpnI/AscI restriction digestion sites.
+
+AtATG8a CDS Gateway entry clone (Dauphinee, A. N. et al., 2019) was then recombined with the pMDC pHusion 1 Gateway vector to obtain the construct driving expression of pHusion-AtATG8a under control of double 35S promoter.
\ No newline at end of file