added data

assays/embryo_transformation/protocols/cloning_trafo_protocol.md

+**cloning**
+
+- cloning of transformation vectors was performed according to the protocol by Kumar et al. (2018)
+- sgRNAs were cloned into recipient vector pMGE599
+- two sgRNA combinations:
+
+| approach | covered CDS sequence (from start codon) | sgRNA sequence (incl. PAM, 5'-3') | construct name | 
+| - | - | - | - |
+| 1 | 7-26, 97-116 | GGCGGTGGCGCAGCCGCGGATGG, GAGATCTATACCTACGAGGCCGG |  pMGE599/7-97
+| 2 | 1182-1201, 1222-1241 | GGTCAGCTACCCAGCCTGACTGG, TAATAAACTGCAGATTCTCA GGG |  pMGE599/182-1222
+
+**transformation**
+
+- gp-fast plants were cultivated in long-day conditions (16h day / 8 night) in control temperature (20°C / 16°C)
+- immature embryos were used for transformation according to Hensel et al. (2009)
+- DNA was extracted from regenerated plants using QIAGEN_DNeasy-Plant-Mini protocol
+- successful insertion of the transformation vector into the genome was tested by PCR using the primers Hyg-156 (5'-ACGCACAATCCCACTATCC-3') and Hyg-047 (5'-GTGTCGTCCATCACAGTTTG-3')
+
+
+**References**
+Hensel G, Kastner C, Oleszczuk S, Riechen J, Kumlehn J (2009) Agrobacterium-mediated gene transfer to cereal crop plants: Current protocols for barley, wheat, triticale, and maize. International Journal of Plant Genomics, 2009: 835608.
+
+Kumar N, Galli M, Ordon J, Stuttmann J, Kogel K-H, Imani J (2018) Further analysis of barley MORC1 using a highly efficient RNA-guided Cas9 gene-editing system. Plant Biotechnology Journal, 16(11): 1892–1903.
\ No newline at end of file

assays/mutant_genotyping/protocols/plant_genotyping.txt

+- DNA extracted from plants using QIAGEN protocol
+- PCR done with primers lwd f/r
+- sent for Sanger sequencing
+- Sequences were evaluated: mutations in CDS of lwd1?
\ No newline at end of file