Skip to content
Snippets Groups Projects
Commit c401308c authored by Dominik Brilhaus's avatar Dominik Brilhaus
Browse files

Merge branch helmsorig-2024-eam7:main into main

parents 320f5ef0 1ec89613
No related branches found
No related tags found
No related merge requests found
Pipeline #7551 failed
Stage: arc_json
    Stage: quality_report_generator
      Stage: quality_report
        Hide whitespace changes
        Inline Side-by-side
        Showing
        with 92 additions and 58 deletions
        assays/plant_propagation/protocols/plant_growth.md 0 → 100644
        + 10
        − 0
        View file @ c401308c
        ## Growth of *lwd1* mutant plants
        - plants were grown until maturity
        **Growth conditions:**
        - long day: (LD) 16h light / 8h dark, 20/16 °C, 60% humidity, ~ 250 PAR)
        - 1.5 L pots (HerkuPlast Kubern GmbH, pot volume 75 cm^3)
        - Einheitserde ED73 (Einheitserde Werkverband e.V.) with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation (ICL Group Ltd.)
        assays/plant_propagation/protocols/plant_propagation.md 0 → 100644
        + 4
        − 0
        View file @ c401308c
        ## Propagation of *lwd1* mutant plants
        - plants were grown until full maturity
        - seeds were harvested for each plant individually
        \ No newline at end of file
        assays/plant_propagation/protocols/progagation_of_mutant_plants.md deleted 100644 → 0
        + 0
        − 8
        View file @ 320f5ef0
        ## Propagation of *lwd1* mutant plants
        - plants were grown in LD conditions until maturity
        - seeds were harvested for each plant individually
        **Generations:**
        - T0 plants: regenerated plants from cell culture (embryo transformation), produce T1 seeds
        - T1 plants: genotyping for potential mutants, produce T2 seeds
        \ No newline at end of file
        assays/qRT-PCR/dataset/eam7_development_gene_expression.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        assays/qRT-PCR/dataset/eam7_diurnal_gene_expression.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        assays/qRT-PCR/dataset/lwd1_diurnal_gene_expression.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        assays/qRT-PCR/isa.assay.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        assays/qRT-PCR/protocols/qRT-PCR_primer.md deleted 100644 → 0
        + 0
        − 44
        View file @ 320f5ef0
        | Target gene | Primer | Sequence 5’-3’ | Fragment size (bp) |
        | - | - | - | - |
        | ACT (HORVU.MOREX.r3.5HG0457850) | ACT_591F | CGTGTTGGATTCTGGTGATG | 208|
        | | ACT_789R | AGCCACATATGCGAGCTTCT | |
        | CO1 (HORVU.MOREX.r3.7HG0671540) | CO1_2185F | CTGCTGGGGCTAGTGCTTAC | 251|
        | | CO1_3454R | CCTTGTTGCATAACGTGTGG | |
        | CO2 (HORVU.MOREX.r3.6HG0611630) | CO2_564F | AGTGGACTCTTGGCTCCTCA | 158 |
        | | CO2_721R | CATGCTGCTGTTCTTGCATT | |
        | ELF3 (HORVU.MOREX.r3.1HG0095050) | ELF3_DL_3060_F3 | TGCTGTCCAAGTGTTTGAGC | 242 |
        | | Elf3_DL_4483_R3 | CCTGGTTTCCTTCGGTGTTA | |
        | FT1 (HORVU.MOREX.r3.7HG0653910) | FT1_1955F | GGTAGACCCAGATGCTCCAA | 120 |
        | | FT1_2183R | TCGTAGCACATCACCTCCTG | |
        | FT2 (HORVU.MOREX.r3.3HG0244930 | FT2_4031R | TCACATCCTTCTCCCGCCGG | 238 |
        | | FT2_3809_F | TACCGAGGTTGTGTGCTACG | |
        | FT3 (HORVU.MOREX.r3.1HG0077250) | FT3-1004F | TGTCAGACATCCCTGGAACA | 225 |
        | | FT3-1848R | CTGATCCACCTTCCCTTTGA | |
        | FT4 (HORVU.MOREX.r3.2HG0117260) | FT4_626F | AAACGATAGCTTTGGAAAAGAGATC | 230 |
        | | FT4_2537R | TCCTCCCGCCGGTGCCCGTG | |
        | GI (HORVU.MOREX.r3.3HG0238250) | GI_6780F | TCAGTTAGAGCTCCTGGAAGT | 263 |
        | | GI_7289R | GGTAGTTTGGGCTTTGGATG | |
        | LHY (HORVU.MOREX.r3.7HG0699010) | HvLHY_672F | CCTGGAATTGGAGATGGAGA | 210 |
        | | HvLHY_882R | TGAGCATGGCTTCTGATTTG | |
        | LUX1 (HORVU.MOREX.r3.3HG0328340) | LUX_1077F | AATTCAGTCCACGGATGCTC | 222 |
        | | LUX_1298R | CTTCACTTCAGCTCCCCTTG | |
        | LWD1 (HORVU.MOREX.r3.6HG0583670) | LWD1_qPCR-114_F | CAGCTCATAGCCCATGACAA | 114 |
        | | LWD1_qPCR-114_R | CTCCTTGTCCCGAAGATCAA | |
        | PHYB (HORVU.MOREX.r3.4HG0381880) | HvPHYB-1151F | CTTGCGCACCAACTATCAGA | 232 |
        | | HvPHYB-1383R | CTCCATGACACACCGTCAAC | |
        | PHYC (HORVU.MOREX.r3.5HG0511090) | PHYC_0986F | ACTACCCGGCAACTGACATC | 142 |
        | | PHYC_1127R | GAGCCACAGAGGCTGATAGG | |
        | Ppd-H1 (HORVU.MOREX.r3.2HG0107710) | PPD1_2165F | GATGGATTCAAAGGCAAGGA | 172 |
        | | PPD1_2336R | GAACAATTGGCTCCTCCAAA | |
        | PRR1 (HORVU.MOREX.r3.6HG0595250) | HvPRR1_1056F | GAGCATAGCATGGCACTTCA | 237 |
        | | HvPRR1_1292R | TGTCTTTCCTCGGAAATTGG | |
        | PRR59 (HORVU.MOREX.r3.4HG0350690) | PRR59_2064_F | GAAATTCCGCATGAAAAGGA | 148 |
        | | PRR59_2212_R | TTCCGCATCTTCTGTTGTTG | |
        | PRR73 (HORVU.MOREX.r3.5HG0498830) | PRR73_441F | GCGCCGTAGAGAATCAGAAC | 222 |
        | | PRR73_662R | CATGTCGGGTACAGTCATCG | |
        | PRR95 (HORVU.MOREX.r3.5HG0498830) | PRR95_1467F | CAGAACTCCAGTGTCGCAAA | 251 |
        | | PRR95_1717R | TGCTGTTGCCAGAGTTGTTC | |
        | VRN1 (HORVU.MOREX.r3.5HG0511210) | HVBM5a_292F | CTGAAGGCGAAGGTTGAGAC | 203 |
        | | HVBM5a_494R | TTCTCCTCCTGCAGTGACCT | |
        \ No newline at end of file
        assays/qRT-PCR/protocols/qRT-PCR_protocol.md
        + 47
        − 1
        View file @ c401308c
        ......@@ -55,4 +55,50 @@ If no standard curve was available:
        **4. Calculate means and standard deviation for all samples**
        - relative expression was averaged over the three biological replicates for each sample
        - standard deviation was calculated across the three biological replicates for each sample
        \ No newline at end of file
        - standard deviation was calculated across the three biological replicates for each sample
        **Primer list:**
        | Target gene | Primer | Sequence 5’-3’ | Fragment size (bp) |
        | - | - | - | - |
        | ACT (HORVU.MOREX.r3.5HG0457850) | ACT_591F | CGTGTTGGATTCTGGTGATG | 208|
        | | ACT_789R | AGCCACATATGCGAGCTTCT | |
        | CO1 (HORVU.MOREX.r3.7HG0671540) | CO1_2185F | CTGCTGGGGCTAGTGCTTAC | 251|
        | | CO1_3454R | CCTTGTTGCATAACGTGTGG | |
        | CO2 (HORVU.MOREX.r3.6HG0611630) | CO2_564F | AGTGGACTCTTGGCTCCTCA | 158 |
        | | CO2_721R | CATGCTGCTGTTCTTGCATT | |
        | ELF3 (HORVU.MOREX.r3.1HG0095050) | ELF3_DL_3060_F3 | TGCTGTCCAAGTGTTTGAGC | 242 |
        | | Elf3_DL_4483_R3 | CCTGGTTTCCTTCGGTGTTA | |
        | FT1 (HORVU.MOREX.r3.7HG0653910) | FT1_1955F | GGTAGACCCAGATGCTCCAA | 120 |
        | | FT1_2183R | TCGTAGCACATCACCTCCTG | |
        | FT2 (HORVU.MOREX.r3.3HG0244930 | FT2_4031R | TCACATCCTTCTCCCGCCGG | 238 |
        | | FT2_3809_F | TACCGAGGTTGTGTGCTACG | |
        | FT3 (HORVU.MOREX.r3.1HG0077250) | FT3-1004F | TGTCAGACATCCCTGGAACA | 225 |
        | | FT3-1848R | CTGATCCACCTTCCCTTTGA | |
        | FT4 (HORVU.MOREX.r3.2HG0117260) | FT4_626F | AAACGATAGCTTTGGAAAAGAGATC | 230 |
        | | FT4_2537R | TCCTCCCGCCGGTGCCCGTG | |
        | GI (HORVU.MOREX.r3.3HG0238250) | GI_6780F | TCAGTTAGAGCTCCTGGAAGT | 263 |
        | | GI_7289R | GGTAGTTTGGGCTTTGGATG | |
        | LHY (HORVU.MOREX.r3.7HG0699010) | HvLHY_672F | CCTGGAATTGGAGATGGAGA | 210 |
        | | HvLHY_882R | TGAGCATGGCTTCTGATTTG | |
        | LUX1 (HORVU.MOREX.r3.3HG0328340) | LUX_1077F | AATTCAGTCCACGGATGCTC | 222 |
        | | LUX_1298R | CTTCACTTCAGCTCCCCTTG | |
        | LWD1 (HORVU.MOREX.r3.6HG0583670) | LWD1_qPCR-114_F | CAGCTCATAGCCCATGACAA | 114 |
        | | LWD1_qPCR-114_R | CTCCTTGTCCCGAAGATCAA | |
        | PHYB (HORVU.MOREX.r3.4HG0381880) | HvPHYB-1151F | CTTGCGCACCAACTATCAGA | 232 |
        | | HvPHYB-1383R | CTCCATGACACACCGTCAAC | |
        | PHYC (HORVU.MOREX.r3.5HG0511090) | PHYC_0986F | ACTACCCGGCAACTGACATC | 142 |
        | | PHYC_1127R | GAGCCACAGAGGCTGATAGG | |
        | Ppd-H1 (HORVU.MOREX.r3.2HG0107710) | PPD1_2165F | GATGGATTCAAAGGCAAGGA | 172 |
        | | PPD1_2336R | GAACAATTGGCTCCTCCAAA | |
        | PRR1 (HORVU.MOREX.r3.6HG0595250) | HvPRR1_1056F | GAGCATAGCATGGCACTTCA | 237 |
        | | HvPRR1_1292R | TGTCTTTCCTCGGAAATTGG | |
        | PRR59 (HORVU.MOREX.r3.4HG0350690) | PRR59_2064_F | GAAATTCCGCATGAAAAGGA | 148 |
        | | PRR59_2212_R | TTCCGCATCTTCTGTTGTTG | |
        | PRR73 (HORVU.MOREX.r3.5HG0498830) | PRR73_441F | GCGCCGTAGAGAATCAGAAC | 222 |
        | | PRR73_662R | CATGTCGGGTACAGTCATCG | |
        | PRR95 (HORVU.MOREX.r3.5HG0498830) | PRR95_1467F | CAGAACTCCAGTGTCGCAAA | 251 |
        | | PRR95_1717R | TGCTGTTGCCAGAGTTGTTC | |
        | VRN1 (HORVU.MOREX.r3.5HG0511210) | HVBM5a_292F | CTGAAGGCGAAGGTTGAGAC | 203 |
        | | HVBM5a_494R | TTCTCCTCCTGCAGTGACCT | |
        \ No newline at end of file
        isa.investigation.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        studies/MSA_dissection_eam7/isa.study.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        studies/allelism_test/isa.study.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        studies/biparental_mapping_eam7/isa.study.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        studies/gene_expression_eam7_plants_development/isa.study.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        studies/gene_expression_eam7_plants_development/protocols/development_plant_material_growth_conditions.md
        + 8
        − 2
        View file @ c401308c
        ......@@ -18,9 +18,15 @@ Genotypes:
        - QuickPot E24/10 trays (HerkuPlast Kubern GmbH, pot volume 480 cm^3)
        - Einheitserde ED73 (Einheitserde Werkverband e.V.) with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation (ICL Group Ltd.)
        **Sampling:**
        **Leaf sampling for RNA extraction:**
        - place two 3 mm metal beads into 2.0 ml tube
        - always sample the youngest, fully elongated leaf (auricles are clearly visible)
        - sample three biological replicates for each genotype and time point
        - for each biological replicate: pool the leaf from two plants into one tube
        - freeze samples directly in liquid nitrogen
        - Store samples at -80°C until needed
        - always sample youngest, fully elongated leaf
        - sample at ZT 9 (1h after lights turned off, as FT1 expression is highest)
        - sample genotypes at 19, 26, 33, 40, 47 and 59 DAE
        ......
        studies/gene_expression_eam7_plants_diurnal/isa.study.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        studies/gene_expression_eam7_plants_diurnal/protocols/diurnal_plant_material_growth_conditions.md
        + 11
        − 1
        View file @ c401308c
        ......@@ -19,7 +19,17 @@ Genotypes:
        - Einheitserde ED73 (Einheitserde Werkverband e.V.) with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation (ICL Group Ltd.)
        **Sampling:**
        **Leaf sampling for RNA extraction:**
        - place two 3 mm metal beads into 2.0 ml tube
        - always sample the youngest, fully elongated leaf (auricles are clearly visible)
        - sample three biological replicates for each genotype and time point
        - for each biological replicate: pool the leaf from two plants into one tube
        - freeze samples directly in liquid nitrogen
        - Store samples at -80°C until needed
        - sample at ZT 9 (1h after lights turned off, as FT1 expression is highest)
        - sample genotypes at 19, 26, 33, 40, 47 and 59 DAE
        - 2 weeks old plants
        - youngest, fully elongated leaf: leaf 2
        ......
        studies/gene_expression_lwd1_mutants_diurnal/README.md
        + 1
        − 1
        View file @ c401308c
        ......@@ -8,7 +8,7 @@ Gene expression of *CO1, ELF3, FT1, LUX1, LWD1, PHYB, PHYC, Ppd-H1*, and *PRR1*
        ```mermaid
        flowchart TD;
        A[lwd1 mutants and GP-fast] --> |leaf_sampling| B[frozen leaf tissues, 3 biol. replicates]
        A[lwd1 mutants and GP-fast] --> |plant growth and leaf sampling| B[frozen leaf tissues, 3 biol. replicates]
        B --> |RNA_extraction| C[RNA samples]
        C --> |cDNA_synthesis| D[cDNA samples]
        D --> |qRT-PCR| E[gene expression data, 2 techn. replicates]
        ......
        studies/gene_expression_lwd1_mutants_diurnal/isa.study.xlsx
        + 0
        − 0
        View file @ c401308c
        No preview for this file type
        studies/gene_expression_lwd1_mutants_diurnal/protocols/diurnal_plant_material_growth_conditions.md
        + 11
        − 1
        View file @ c401308c
        ......@@ -20,7 +20,17 @@ Genotypes:
        - Einheitserde ED73 (Einheitserde Werkverband e.V.) with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation (ICL Group Ltd.)
        **Sampling:**
        **Leaf sampling for RNA extraction:**
        - place two 3 mm metal beads into 2.0 ml tube
        - always sample the youngest, fully elongated leaf (auricles are clearly visible)
        - sample three biological replicates for each genotype and time point
        - for each biological replicate: pool the leaf from two plants into one tube
        - freeze samples directly in liquid nitrogen
        - Store samples at -80°C until needed
        - sample at ZT 9 (1h after lights turned off, as FT1 expression is highest)
        - sample genotypes at 19, 26, 33, 40, 47 and 59 DAE
        - 2 weeks old plants
        - youngest, fully elongated leaf: leaf 2
        ......
        0% or .
        You are about to add 0 people to the discussion. Proceed with caution.
        Finish editing this message first!
        Please register or to comment